/
BirdLeon
/
ROBLOX2016
Обзор
Документация
Войти
/
BirdLeon
/
ROBLOX2016
Код
Запросы
0
Задачи
Вики
Пакеты
0
Релизы
0
Аналитика
Безопасность
main
Library/boost/libs/algorithm/test/search_test1.cpp
285 строк
12 KB
PatoFlamejanteTV
full source code
19 дек 2024, 19:11
19 дек 2024, 19:11
05db15d
Код
Авторство
О чём код?
/* Copyright (c) Marshall Clow 2010-2012. Distributed under the Boost Software License, Version 1.0. (See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt) For more information, see http://www.boost.org */ #include <boost/algorithm/searching/boyer_moore.hpp> #include <boost/algorithm/searching/boyer_moore_horspool.hpp> #include <boost/algorithm/searching/knuth_morris_pratt.hpp> #define BOOST_TEST_MAIN #include <boost/test/unit_test.hpp> #include <iostream> #include <string> #include <vector> namespace ba = boost::algorithm; template <typename Iter> std::string make_str ( Iter first, std::size_t len ) { std::string retVal ( len + 2, '\'' ); std::copy ( first, first+len, retVal.begin () + 1); return retVal; } namespace { // Check using iterators template<typename Container> void check_one_iter ( const Container &haystack, const std::string &needle, int expected ) { typedef typename Container::const_iterator iter_type; typedef typename std::pair<iter_type, iter_type> ret_type; typedef std::string::const_iterator pattern_type; iter_type hBeg = haystack.begin (); iter_type hEnd = haystack.end (); pattern_type nBeg = needle.begin (); pattern_type nEnd = needle.end (); // iter_type ret0 = std::search (hBeg, hEnd, nBeg, nEnd); ret_type ret1 = ba::boyer_moore_search (hBeg, hEnd, nBeg, nEnd); ret_type ret1r = ba::boyer_moore_search (haystack, nBeg, nEnd); ret_type ret2 = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd); ret_type ret3 = ba::knuth_morris_pratt_search (hBeg, hEnd, nBeg, nEnd); iter_type it0 = std::search (hBeg, hEnd, nBeg, nEnd); // iter_type it1 = ret1.first; // iter_type it1r = ret1r.first; // iter_type it2 = ret2.first; // iter_type it3 = ret3.first; const int dist = ret1.first == hEnd ? -1 : std::distance ( hBeg, ret1.first ); std::cout << "(Iterators) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl; try { if ( it0 != ret1.first ) { throw std::runtime_error ( std::string ( "results mismatch between std::search and boyer-moore search" )); } if ( ret1.first != ret1r.first || ret1.second != ret1r.second ) { throw std::runtime_error ( std::string ( "results mismatch between iterator and range boyer_moore search" )); } if ( ret1.first != ret2.first || ret1.second != ret2.second ) { throw std::runtime_error ( std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" )); } if ( ret1.first != ret3.first || ret1.second != ret3.second ) { throw std::runtime_error ( std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" )); } } catch ( ... ) { std::cout << "Searching for: " << needle << std::endl; std::cout << "Expected: " << expected << "\n"; std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n"; std::cout << " bm: " << std::distance ( hBeg, ret1.first ) << "\n"; std::cout << " bm(r): " << std::distance ( hBeg, ret1r.first ) << "\n"; std::cout << " bmh: " << std::distance ( hBeg, ret2.first ) << "\n"; std::cout << " kpm: " << std::distance ( hBeg, ret3.first )<< "\n"; std::cout << std::flush; throw ; } BOOST_CHECK_EQUAL ( dist, expected ); } // Check using pointers // We're assuming that the container implements contiguous storage here. template<typename Container> void check_one_pointer ( const Container &haystack, const std::string &needle, int expected ) { typedef const typename Container::value_type *ptr_type; typedef typename std::pair<ptr_type, ptr_type> ret_type; ptr_type hBeg = haystack.size () == 0 ? NULL : &*haystack.begin (); ptr_type hEnd = hBeg + haystack.size (); ptr_type nBeg = needle.size () == 0 ? NULL : &*needle.begin (); ptr_type nEnd = nBeg + needle.size (); ptr_type it0 = std::search (hBeg, hEnd, nBeg, nEnd); ret_type ret1 = ba::boyer_moore_search (hBeg, hEnd, nBeg, nEnd); ret_type ret2 = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd); ret_type ret3 = ba::knuth_morris_pratt_search (hBeg, hEnd, nBeg, nEnd); const int dist = ret1.first == hEnd ? -1 : std::distance ( hBeg, ret1.first ); std::cout << "(Pointers) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl; try { if ( it0 != ret1.first ) { throw std::runtime_error ( std::string ( "results mismatch between std::search and boyer-moore search" )); } if ( ret1.first != ret2.first || ret1.second != ret2.second ) { throw std::runtime_error ( std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" )); } if ( ret1.first != ret3.first || ret1.second != ret3.second ) { throw std::runtime_error ( std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" )); } } catch ( ... ) { std::cout << "Searching for: " << needle << std::endl; std::cout << "Expected: " << expected << "\n"; std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n"; std::cout << " bm: " << std::distance ( hBeg, ret1.first ) << "\n"; std::cout << " bmh: " << std::distance ( hBeg, ret2.first ) << "\n"; std::cout << " kpm: " << std::distance ( hBeg, ret3.first )<< "\n"; std::cout << std::flush; throw ; } BOOST_CHECK_EQUAL ( dist, expected ); } // Check using objects template<typename Container> void check_one_object ( const Container &haystack, const std::string &needle, int expected ) { typedef typename Container::const_iterator iter_type; typedef typename std::pair<iter_type, iter_type> ret_type; typedef std::string::const_iterator pattern_type; iter_type hBeg = haystack.begin (); iter_type hEnd = haystack.end (); pattern_type nBeg = needle.begin (); pattern_type nEnd = needle.end (); ba::boyer_moore<pattern_type> bm_r = ba::make_boyer_moore ( needle ); ba::boyer_moore<pattern_type> bm ( nBeg, nEnd ); ba::boyer_moore_horspool<pattern_type> bmh ( nBeg, nEnd ); ba::knuth_morris_pratt<pattern_type> kmp ( nBeg, nEnd ); iter_type it0 = std::search (hBeg, hEnd, nBeg, nEnd); ret_type ret1 = bm (hBeg, hEnd); ret_type ret1r = bm (haystack); ret_type retr1 = bm_r (hBeg, hEnd); ret_type retr1r = bm_r (haystack); ret_type ret2 = bmh (hBeg, hEnd); ret_type ret3 = kmp (hBeg, hEnd); const int dist = ret1.first == hEnd ? -1 : std::distance ( hBeg, ret1.first ); std::cout << "(Objects) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl; try { if ( it0 != ret1.first ) { throw std::runtime_error ( std::string ( "results mismatch between std::search and boyer-moore search" )); } if ( ret1.first != ret1r.first || ret1.second != ret1r.second ) { throw std::runtime_error ( std::string ( "results mismatch between iterator and range boyer_moore search(1)" )); } if ( ret1.first != retr1.first || ret1.second != retr1.second ) { throw std::runtime_error ( std::string ( "results mismatch between iterator and range boyer_moore search(2)" )); } if ( ret1.first != retr1r.first || ret1.second != retr1r.second ) { throw std::runtime_error ( std::string ( "results mismatch between iterator and range boyer_moore search(3)" )); } if ( ret1.first != ret2.first || ret1.second != ret2.second ) { throw std::runtime_error ( std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" )); } if ( ret1.first != ret3.first || ret1.second != ret3.second ) { throw std::runtime_error ( std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" )); } } catch ( ... ) { std::cout << "Searching for: " << needle << std::endl; std::cout << "Expected: " << expected << "\n"; std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n"; std::cout << " bm: " << std::distance ( hBeg, ret1.first ) << "\n"; std::cout << " bm(r1): " << std::distance ( hBeg, ret1r.first ) << "\n"; std::cout << " bm(r2): " << std::distance ( hBeg, retr1.first ) << "\n"; std::cout << " bm(r3): " << std::distance ( hBeg, retr1r.first ) << "\n"; std::cout << " bmh: " << std::distance ( hBeg, ret2.first ) << "\n"; std::cout << " kpm: " << std::distance ( hBeg, ret3.first )<< "\n"; std::cout << std::flush; throw ; } BOOST_CHECK_EQUAL ( dist, expected ); } template<typename Container> void check_one ( const Container &haystack, const std::string &needle, int expected ) { check_one_iter ( haystack, needle, expected ); check_one_pointer ( haystack, needle, expected ); check_one_object ( haystack, needle, expected ); } } BOOST_AUTO_TEST_CASE( test_main ) { std::string haystack1 ( "NOW AN FOWE\220ER ANNMAN THE ANPANMANEND" ); std::string needle1 ( "ANPANMAN" ); std::string needle2 ( "MAN THE" ); std::string needle3 ( "WE\220ER" ); std::string needle4 ( "NOW " ); // At the beginning std::string needle5 ( "NEND" ); // At the end std::string needle6 ( "NOT FOUND" ); // Nowhere std::string needle7 ( "NOT FO\340ND" ); // Nowhere std::string haystack2 ( "ABC ABCDAB ABCDABCDABDE" ); std::string needle11 ( "ABCDABD" ); std::string haystack3 ( "abra abracad abracadabra" ); std::string needle12 ( "abracadabra" ); std::string needle13 ( "" ); std::string haystack4 ( "" ); check_one ( haystack1, needle1, 26 ); check_one ( haystack1, needle2, 18 ); check_one ( haystack1, needle3, 9 ); check_one ( haystack1, needle4, 0 ); check_one ( haystack1, needle5, 33 ); check_one ( haystack1, needle6, -1 ); check_one ( haystack1, needle7, -1 ); check_one ( needle1, haystack1, -1 ); // cant find long pattern in short corpus check_one ( haystack1, haystack1, 0 ); // find something in itself check_one ( haystack2, haystack2, 0 ); // find something in itself check_one ( haystack2, needle11, 15 ); check_one ( haystack3, needle12, 13 ); check_one ( haystack1, needle13, 0 ); // find the empty string check_one ( haystack4, needle1, -1 ); // can't find in an empty haystack // Mikhail Levin <svarneticist@gmail.com> found a problem, and this was the test // that triggered it. const std::string mikhail_pattern = "GATACACCTACCTTCACCAGTTACTCTATGCACTAGGTGCGCCAGGCCCATGCACAAGGGCTTGAGTGGATGGGAAGGA" "TGTGCCCTAGTGATGGCAGCATAAGCTACGCAGAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACATCCACGAG" "CACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCCATGTATTACTGTGGGAGAGATGTCTGGAGTGGT" "TATTATTGCCCCGGTAATATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACG" ; const std::string mikhail_corpus = std::string (8, 'a') + mikhail_pattern; check_one ( mikhail_corpus, mikhail_pattern, 8 ); }